Detail of EST/Unigene BE321453 |
Acc. | BE321453 |
Internal Acc. | NF025E10IN1F1071 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutamine synthetase leaf isozyme, chloroplastic OS=Medicago sativa E-value=4e-73; Glutamine synthetase leaf isozyme, chloroplastic OS=Pisum sativum E-value=2e-67; Glutamine synthetase leaf isozyme, chloroplastic OS=Phaseolus vulgaris E-value=1e-59; Glutamine synthetase, chloroplastic OS=Daucus carota E-value=2e-57; Glutamine synthetase, chloroplastic/mitochondrial OS=Arabidopsis thaliana E-value=4e-53; |
Length | 562 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | GTTTGCAGCTTTTTGCCATTTTTCAACTCTGTATTGAACATGGCACAGATTTTGGCTCCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Energy Metabolism > ko00910 Nitrogen metabolism > K01915 glutamine synthetase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01915 glutamine synthetase; Metabolism > Glycan Biosynthesis and Metabolism > ko00550 Peptidoglycan biosynthesis > K01915 glutamine synthetase; Environmental Information Processing > Signal Transduction > ko02020 Two-component system > K01915 glutamine synthetase |
EC | 6.3.1.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 833535 |
Trichome-related Gene from Literature | N/A |