Detail of EST/Unigene BE321571 |
Acc. | BE321571 |
Internal Acc. | NF025B09IN1F1073 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Lipoxygenase 2.3, chloroplastic OS=Hordeum vulgare E-value=2e-13; Linoleate 13S-lipoxygenase 2-1, chloroplastic OS=Solanum tuberosum E-value=3e-11; Probable lipoxygenase 8, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-09; Lipoxygenase 7, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-08; |
Length | 546 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | CTCAATTATTATTTATAGTATAAATCTTAGTGCATTATCTTAAAATATAGAAGCAAGAAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 838314 |
Trichome-related Gene from Literature | N/A |