Detail of EST/Unigene BE321633 |
Acc. | BE321633 |
Internal Acc. | NF022H07IN1F1060 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | ALBINO3-like protein 1, chloroplastic OS=Arabidopsis thaliana E-value=4e-34; Inner membrane protein ALBINO3, chloroplastic OS=Arabidopsis thaliana E-value=7e-29; Inner membrane protein PPF-1, chloroplastic OS=Pisum sativum E-value=1e-28; Inner membrane ALBINO3-like protein 2, chloroplastic OS=Chlamydomonas reinhardtii E-value=7e-23; Inner membrane ALBINO3-like protein 1, chloroplastic OS=Chlamydomonas reinhardtii E-value=1e-18; |
Length | 261 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | CTGGAATTACCAATTACATGGAAATTATTCTCAAGGTACTCAAGGACGGGCTTTCTACTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | 2.A.9 Cytochrome oxidase biogenesis factor Oxa1 |
Probeset |
|
Corresponding NCBI Gene | 839065 |
Trichome-related Gene from Literature | N/A |