| Detail of EST/Unigene BE321633 |
| Acc. | BE321633 |
| Internal Acc. | NF022H07IN1F1060 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | ALBINO3-like protein 1, chloroplastic OS=Arabidopsis thaliana E-value=4e-34; Inner membrane protein ALBINO3, chloroplastic OS=Arabidopsis thaliana E-value=7e-29; Inner membrane protein PPF-1, chloroplastic OS=Pisum sativum E-value=1e-28; Inner membrane ALBINO3-like protein 2, chloroplastic OS=Chlamydomonas reinhardtii E-value=7e-23; Inner membrane ALBINO3-like protein 1, chloroplastic OS=Chlamydomonas reinhardtii E-value=1e-18; |
| Length | 261 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT; |
| Sequence | CTGGAATTACCAATTACATGGAAATTATTCTCAAGGTACTCAAGGACGGGCTTTCTACTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | 2.A.9 Cytochrome oxidase biogenesis factor Oxa1 |
| Probeset |
|
| Corresponding NCBI Gene | 839065 |
| Trichome-related Gene from Literature | N/A |