| Detail of EST/Unigene BE321736 |
| Acc. | BE321736 |
| Internal Acc. | NF006B09IN1F1074 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Aspartate aminotransferase, mitochondrial OS=Arabidopsis thaliana E-value=5e-34; Aspartate aminotransferase, mitochondrial OS=Rattus norvegicus E-value=8e-19; Aspartate aminotransferase, mitochondrial OS=Pongo abelii E-value=4e-18; Aspartate aminotransferase, mitochondrial OS=Sus scrofa E-value=4e-18; Aspartate aminotransferase, mitochondrial OS=Mus musculus E-value=4e-18; |
| Length | 341 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT; |
| Sequence | GTTTTTTCTTCTTTCATTTCCTCTGTTCTCTGTTTCCATGGCGATTCGCAATCTTCTCAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00950 Alkaloid biosynthesis I > K00813 aspartate aminotransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00401 Novobiocin biosynthesis > K00813 aspartate aminotransferase; Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K00813 aspartate aminotransferase; Metabolism > Amino Acid Metabolism > ko00252 Alanine and aspartate metabolism > K00813 aspartate aminotransferase; Metabolism > Amino Acid Metabolism > ko00330 Arginine and proline metabolism > K00813 aspartate aminotransferase; Metabolism > Amino Acid Metabolism > ko00272 Cysteine metabolism > K00813 aspartate aminotransferase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K00813 aspartate aminotransferase; Metabolism > Amino Acid Metabolism > ko00360 Phenylalanine metabolism > K00813 aspartate aminotransferase; Metabolism > Amino Acid Metabolism > ko00400 Phenylalanine, tyrosine and tryptophan b |
| EC | 2.6.1.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817648 |
| Trichome-related Gene from Literature | N/A |