| Detail of EST/Unigene BE321857 |
| Acc. | BE321857 |
| Internal Acc. | NF045E08IN1F1056 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 6A, chloroplastic OS=Solanum lycopersicum E-value=1e-29; Chlorophyll a-b binding protein 6, chloroplastic OS=Arabidopsis thaliana E-value=8e-27; Chlorophyll a-b binding protein 1B-21, chloroplastic OS=Hordeum vulgare Ib-21 E-value=1e-25; Chlorophyll a-b binding protein 7, chloroplastic OS=Solanum lycopersicum E-value=6e-14; Chlorophyll a-b binding protein, chloroplastic OS=Petunia hybrida E-value=2e-13; |
| Length | 273 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT; |
| Sequence | TCCATCACTTCTTTCTTCCTCAAAATCAAGATTTTCAACTTCACTTCCACTTCCTTGTAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 824654 |
| Trichome-related Gene from Literature | N/A |