| Detail of EST/Unigene BE321947 |
| Acc. | BE321947 |
| Internal Acc. | NF042A10IN1F1070 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Sedoheptulose-1,7-bisphosphatase, chloroplastic OS=Spinacia oleracea E-value=5e-36; Sedoheptulose-1,7-bisphosphatase, chloroplastic OS=Arabidopsis thaliana E-value=2e-32; Sedoheptulose-1,7-bisphosphatase, chloroplastic OS=Triticum aestivum E-value=2e-29; Sedoheptulose-1,7-bisphosphatase, chloroplastic OS=Chlamydomonas reinhardtii E-value=6e-21; |
| Length | 442 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT; |
| Sequence | AACTTTTCAACATAATTTTTTTTTCAGCCATGGAAACTAGTATAGCATGTTACCTCCAGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 824746 |
| Trichome-related Gene from Literature | N/A |