Detail of EST/Unigene BE321976 |
Acc. | BE321976 |
Internal Acc. | NF042D01IN1F1011 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Protochlorophyllide reductase, chloroplastic OS=Pisum sativum E-value=8e-46; Protochlorophyllide reductase, chloroplastic OS=Cucumis sativus E-value=7e-44; Protochlorophyllide reductase A, chloroplastic OS=Arabidopsis thaliana E-value=3e-37; Protochlorophyllide reductase, chloroplastic OS=Daucus carota E-value=1e-36; Protochlorophyllide reductase B, chloroplastic OS=Arabidopsis thaliana E-value=3e-33; |
Length | 385 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | TTACAAAAGAGGGAAAGATTGGTGCATCTCTCAAGGATTCAACATTTTTTGGTGTTTCAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.1.1.- |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835507 |
Trichome-related Gene from Literature | N/A |