Detail of EST/Unigene BE322131 |
Acc. | BE322131 |
Internal Acc. | NF010D11IN1F1091 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 1, chloroplastic OS=Arabidopsis thaliana E-value=1e-73; Chlorophyll a-b binding protein 3, chloroplastic OS=Arabidopsis thaliana E-value=4e-73; Chlorophyll a-b binding protein 2, chloroplastic OS=Arabidopsis thaliana E-value=4e-73; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=5e-73; Chlorophyll a-b binding protein 3, chloroplastic OS=Glycine max E-value=9e-73; |
Length | 640 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | AAATAATCCTCCTCTTCATTTTCAATAGAACTACTCGTTTGTTTAACTTAGTTACCAAAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |