Detail of EST/Unigene BE322133 |
Acc. | BE322133 |
Internal Acc. | NF010D12IN1F1095 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Linoleate 13S-lipoxygenase 2-1, chloroplastic OS=Solanum tuberosum E-value=1e-61; Lipoxygenase 2.3, chloroplastic OS=Hordeum vulgare E-value=8e-52; Lipoxygenase 4, chloroplastic OS=Arabidopsis thaliana E-value=2e-51; Lipoxygenase 3, chloroplastic OS=Arabidopsis thaliana E-value=6e-49; Lipoxygenase 2, chloroplastic OS=Arabidopsis thaliana E-value=2e-47; |
Length | 539 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | CTTGTTTTTGGTTCAAAAAGAGACAAAATTGGAGAAGGAAAGAATCAAAGGTTACGTCCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 843584 |
Trichome-related Gene from Literature | N/A |