Detail of EST/Unigene BE322135 |
Acc. | BE322135 |
Internal Acc. | NF010E12IN1F1088 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Endo-1,3;1,4-beta-D-glucanase OS=Zea mays E-value=3e-27; Carboxymethylenebutenolidase homolog OS=Mus musculus E-value=2e-15; Carboxymethylenebutenolidase homolog OS=Homo sapiens E-value=5e-14; Carboxymethylenebutenolidase homolog OS=Pongo abelii E-value=8e-14; Carboxymethylenebutenolidase homolog OS=Rattus norvegicus E-value=2e-13; |
Length | 584 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | CTTCGATATTATAGATACGTGTAGTAGTAGTAGTAGCTAGAACCTACCCTTGGAATAATA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00627 1,4-Dichlorobenzene degradation > K01061 carboxymethylenebutenolidase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00364 Fluorobenzoate degradation > K01061 carboxymethylenebutenolidase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00361 gamma-Hexachlorocyclohexane degradation > K01061 carboxymethylenebutenolidase |
EC | 3.1.-.- 3.1.1.45 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 821939 |
Trichome-related Gene from Literature | N/A |