Detail of EST/Unigene BE322779 |
Acc. | BE322779 |
Internal Acc. | NF047F08IN1F1064 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | U-box domain-containing protein 21 OS=Arabidopsis thaliana E-value=3e-33; E3 ubiquitin-protein ligase PUB23 OS=Arabidopsis thaliana E-value=3e-30; U-box domain-containing protein 26 OS=Arabidopsis thaliana E-value=8e-30; E3 ubiquitin-protein ligase PUB22 OS=Arabidopsis thaliana E-value=1e-29; U-box domain-containing protein 20 OS=Arabidopsis thaliana E-value=2e-29; |
Length | 521 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | AATCCTTCATTCCAAGAACAAAACAAAAAAAACACAAACACAAATTTCATAAAACAAAAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K03175 TNF receptor-associated factor 6; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K03175 TNF receptor-associated factor 6; Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K09561 STIP1 homology and U-box containing protein 1 |
EC | 6.3.2.19 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 833727 |
Trichome-related Gene from Literature | N/A |