| Detail of EST/Unigene BE322835 |
| Acc. | BE322835 |
| Internal Acc. | NF048F05IN1F1044 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein CP29.3, chloroplastic OS=Arabidopsis thaliana E-value=7e-35; Chlorophyll a-b binding protein CP29.1, chloroplastic OS=Arabidopsis thaliana E-value=1e-29; Chlorophyll a-b binding protein CP29.2, chloroplastic OS=Arabidopsis thaliana E-value=4e-29; Chlorophyll a-b binding protein CP29 OS=Chlamydomonas reinhardtii E-value=1e-12; Chlorophyll a-b binding protein, chloroplastic OS=Petunia hybrida E-value=7e-08; |
| Length | 442 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT; |
| Sequence | ATACCTTGTTCCTAAATCCAAACAAAGCCAGCCACCATGGCAACCACCGCAACCGCCGCC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818599 |
| Trichome-related Gene from Literature | N/A |