Detail of EST/Unigene BE322835 |
Acc. | BE322835 |
Internal Acc. | NF048F05IN1F1044 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein CP29.3, chloroplastic OS=Arabidopsis thaliana E-value=7e-35; Chlorophyll a-b binding protein CP29.1, chloroplastic OS=Arabidopsis thaliana E-value=1e-29; Chlorophyll a-b binding protein CP29.2, chloroplastic OS=Arabidopsis thaliana E-value=4e-29; Chlorophyll a-b binding protein CP29 OS=Chlamydomonas reinhardtii E-value=1e-12; Chlorophyll a-b binding protein, chloroplastic OS=Petunia hybrida E-value=7e-08; |
Length | 442 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | ATACCTTGTTCCTAAATCCAAACAAAGCCAGCCACCATGGCAACCACCGCAACCGCCGCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818599 |
Trichome-related Gene from Literature | N/A |