Detail of EST/Unigene BE323063 |
Acc. | BE323063 |
Internal Acc. | NF013C11PL1F1082 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=2e-59; Chlorophyll a-b binding protein 8, chloroplastic OS=Pisum sativum E-value=1e-58; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=2e-52; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=3e-52; Chlorophyll a-b binding protein 22L, chloroplastic OS=Petunia sp. E-value=4e-52; |
Length | 398 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | GCACAACAAGCATTTTAATTTCATTGCAAAATGGCCGCATCATCCATGGCTCTCTCTTCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818006 |
Trichome-related Gene from Literature | N/A |