Detail of EST/Unigene BE323107 |
Acc. | BE323107 |
Internal Acc. | NF004B04PL1F1029 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Digalactosyldiacylglycerol synthase 1, chloroplastic OS=Glycine max E-value=9e-50; Digalactosyldiacylglycerol synthase 1, chloroplastic OS=Lotus japonicus E-value=2e-49; Digalactosyldiacylglycerol synthase 1, chloroplastic OS=Arabidopsis thaliana E-value=2e-47; Digalactosyldiacylglycerol synthase 2, chloroplastic OS=Arabidopsis thaliana E-value=2e-36; Digalactosyldiacylglycerol synthase 2, chloroplastic OS=Glycine max E-value=1e-35; |
Length | 339 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | AAATTCAACCATGTTGTTGGCATTGTGCACACAAATTACTTAGAATACATCAAGAGGGAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820339 |
Trichome-related Gene from Literature | N/A |