| Detail of EST/Unigene BE323157 |
| Acc. | BE323157 |
| Internal Acc. | NF003B11PL1F1089 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Digalactosyldiacylglycerol synthase 1, chloroplastic OS=Lotus japonicus E-value=4e-80; Digalactosyldiacylglycerol synthase 1, chloroplastic OS=Glycine max E-value=1e-79; Digalactosyldiacylglycerol synthase 1, chloroplastic OS=Arabidopsis thaliana E-value=2e-79; Digalactosyldiacylglycerol synthase 2, chloroplastic OS=Glycine max E-value=5e-60; Digalactosyldiacylglycerol synthase 2, chloroplastic OS=Lotus japonicus E-value=9e-60; |
| Length | 514 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF; |
| Sequence | GTAACTGGCTTGAGGAAAGGATTGGATTTAAGGCAGACTTCAAAATATCTTTTTATCCTG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820339 |
| Trichome-related Gene from Literature | N/A |