Detail of EST/Unigene BE323157 |
Acc. | BE323157 |
Internal Acc. | NF003B11PL1F1089 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Digalactosyldiacylglycerol synthase 1, chloroplastic OS=Lotus japonicus E-value=4e-80; Digalactosyldiacylglycerol synthase 1, chloroplastic OS=Glycine max E-value=1e-79; Digalactosyldiacylglycerol synthase 1, chloroplastic OS=Arabidopsis thaliana E-value=2e-79; Digalactosyldiacylglycerol synthase 2, chloroplastic OS=Glycine max E-value=5e-60; Digalactosyldiacylglycerol synthase 2, chloroplastic OS=Lotus japonicus E-value=9e-60; |
Length | 514 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | GTAACTGGCTTGAGGAAAGGATTGGATTTAAGGCAGACTTCAAAATATCTTTTTATCCTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820339 |
Trichome-related Gene from Literature | N/A |