Detail of EST/Unigene BE323162 |
Acc. | BE323162 |
Internal Acc. | NF001C07PL1F1050 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Plastoglobulin-1, chloroplastic OS=Pisum sativum E-value=8e-29; Plastid lipid-associated protein 3, chloroplastic OS=Brassica campestris E-value=9e-10; Probable plastid-lipid-associated protein 3, chloroplastic OS=Arabidopsis thaliana E-value=1e-09; Probable plastid-lipid-associated protein 3, chloroplastic OS=Oryza sativa subsp. japonica E-value=8e-08; |
Length | 399 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | CTTCTCTCCCCTCTCGAATCTCTCCCTCTCCTCGCTCTCACAGATTCCCTTCTCTCCGCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818114 |
Trichome-related Gene from Literature | N/A |