Detail of EST/Unigene BE323179 |
Acc. | BE323179 |
Internal Acc. | NF003D09PL1F1074 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=2e-42; Chlorophyll a-b binding protein 8, chloroplastic OS=Pisum sativum E-value=1e-41; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=2e-35; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=2e-35; Chlorophyll a-b binding protein 22L, chloroplastic OS=Petunia sp. E-value=1e-34; |
Length | 327 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | CAAAAGCACAACAAGCATTTTAATTTCATTGCAAAATGGCCGCATCATCCATGGCTCTCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818006 |
Trichome-related Gene from Literature | N/A |