| Detail of EST/Unigene BE323297 |
| Acc. | BE323297 |
| Internal Acc. | NF005E03PL1F1019 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | NAD(P)H-quinone oxidoreductase chain 4, chloroplastic OS=Lotus japonicus E-value=2e-49; NAD(P)H-quinone oxidoreductase chain 4, chloroplastic OS=Carica papaya E-value=6e-48; NAD(P)H-quinone oxidoreductase chain 4, chloroplastic OS=Eucalyptus globulus subsp. globulus E-value=1e-46; NAD(P)H-quinone oxidoreductase chain 4, chloroplastic OS=Glycine max E-value=4e-46; NAD(P)H-quinone oxidoreductase chain 4, chloroplastic OS=Atropa belladonna E-value=4e-46; |
| Length | 351 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF; |
| Sequence | AATATTTTGTATTTTTTTTTGAGCACGGGCTTTTCTGGCCCAAGTGTATCTTATTTTTAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |