Detail of EST/Unigene BE323338 |
Acc. | BE323338 |
Internal Acc. | NF006C06PL1F1038 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein E, chloroplastic OS=Nicotiana plumbaginifolia E-value=1e-39; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=2e-39; Chlorophyll a-b binding protein 3, chloroplastic OS=Glycine max E-value=2e-39; Chlorophyll a-b binding protein 1, chloroplastic OS=Arabidopsis thaliana E-value=3e-39; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=4e-39; |
Length | 372 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | CATTTTCAATAGAGCTATTTATTTGCATTTAACTAAGTTGCAAATAAAATACTAGAATGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |