Detail of EST/Unigene BE323342 |
Acc. | BE323342 |
Internal Acc. | NF006D08PL1F1062 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L2, chloroplastic OS=Panax ginseng E-value=1e-34; 50S ribosomal protein L2, chloroplastic OS=Lactuca sativa E-value=1e-33; 50S ribosomal protein L2, chloroplastic OS=Vitis vinifera E-value=1e-33; 50S ribosomal protein L2, chloroplastic OS=Nicotiana tabacum E-value=1e-33; 50S ribosomal protein L2, chloroplastic OS=Nicotiana tomentosiformis E-value=1e-33; |
Length | 466 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | AAAACATTGGGTCGAACTCTTTTTTGGTGTCAAGGTAATAGCTATGAATAGTCATCGACT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |