Detail of EST/Unigene BE323487 |
Acc. | BE323487 |
Internal Acc. | NF009B10PL1F1077 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Oxygen-evolving enhancer protein 1, chloroplastic OS=Pisum sativum E-value=5e-69; Oxygen-evolving enhancer protein 1, chloroplastic OS=Nicotiana tabacum E-value=8e-64; Oxygen-evolving enhancer protein 1, chloroplastic OS=Spinacia oleracea E-value=1e-63; Oxygen-evolving enhancer protein 1, chloroplastic OS=Fritillaria agrestis E-value=4e-62; Oxygen-evolving enhancer protein 1, chloroplastic OS=Helianthus annuus E-value=6e-61; |
Length | 420 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | CGGCTCTGTCAAATTTGAGGAGAAAGATGGCATTGACTACGCCGCAGTCACAGTTCAGCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824246 |
Trichome-related Gene from Literature | N/A |