| Detail of EST/Unigene BE323509 |
| Acc. | BE323509 |
| Internal Acc. | NF009F10PL1F1079 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Protochlorophyllide reductase, chloroplastic OS=Pisum sativum E-value=3e-59; Protochlorophyllide reductase, chloroplastic OS=Daucus carota E-value=3e-58; Protochlorophyllide reductase B, chloroplastic OS=Arabidopsis thaliana E-value=8e-57; Protochlorophyllide reductase A, chloroplastic OS=Arabidopsis thaliana E-value=5e-56; Protochlorophyllide reductase B, chloroplastic OS=Hordeum vulgare E-value=1e-55; |
| Length | 436 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF; |
| Sequence | AGGATTTGAGCTTAGTGTTGGGACAAACCATCTTGGACACTTTCTTCTTTCGCGCCTTTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828853 |
| Trichome-related Gene from Literature | N/A |