Detail of EST/Unigene BE323509 |
Acc. | BE323509 |
Internal Acc. | NF009F10PL1F1079 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Protochlorophyllide reductase, chloroplastic OS=Pisum sativum E-value=3e-59; Protochlorophyllide reductase, chloroplastic OS=Daucus carota E-value=3e-58; Protochlorophyllide reductase B, chloroplastic OS=Arabidopsis thaliana E-value=8e-57; Protochlorophyllide reductase A, chloroplastic OS=Arabidopsis thaliana E-value=5e-56; Protochlorophyllide reductase B, chloroplastic OS=Hordeum vulgare E-value=1e-55; |
Length | 436 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | AGGATTTGAGCTTAGTGTTGGGACAAACCATCTTGGACACTTTCTTCTTTCGCGCCTTTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828853 |
Trichome-related Gene from Literature | N/A |