Detail of EST/Unigene BE323556 |
Acc. | BE323556 |
Internal Acc. | NF010H11PL1F1092 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein CP24 10B, chloroplastic OS=Solanum lycopersicum E-value=3e-31; Chlorophyll a-b binding protein CP24, chloroplastic OS=Spinacia oleracea E-value=1e-29; Chlorophyll a-b binding protein CP24 10A, chloroplastic OS=Solanum lycopersicum E-value=2e-29; Chlorophyll a-b binding protein, chloroplastic OS=Petunia hybrida E-value=3e-13; Chlorophyll a-b binding protein 7, chloroplastic OS=Solanum lycopersicum E-value=3e-11; |
Length | 351 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | CTCATTACTCTTTATCTCTAGAAGACAAATGGCAGCTGCAACATCTGGTGCTGTGTTGAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 838151 |
Trichome-related Gene from Literature | N/A |