Detail of EST/Unigene BE323583 |
Acc. | BE323583 |
Internal Acc. | NF016C08PL1F1055 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutamine synthetase leaf isozyme, chloroplastic OS=Medicago sativa E-value=8e-48; Glutamine synthetase leaf isozyme, chloroplastic OS=Pisum sativum E-value=7e-44; Glutamine synthetase leaf isozyme, chloroplastic OS=Phaseolus vulgaris E-value=5e-35; Glutamine synthetase, chloroplastic OS=Daucus carota E-value=2e-32; Glutamine synthetase, chloroplastic OS=Brassica napus E-value=6e-27; |
Length | 386 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | CACTGACACAAGGCTCATTCTCATTCACTTGAACCCATTTCCTAAGTTTGCAGCTTTTTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 833535 |
Trichome-related Gene from Literature | N/A |