Detail of EST/Unigene BE323642 |
Acc. | BE323642 |
Internal Acc. | NF006E10PL1F1071 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Carotenoid 9,10(9',10')-cleavage dioxygenase 1 OS=Pisum sativum E-value=4e-68; Carotenoid 9,10(9',10')-cleavage dioxygenase 1 OS=Phaseolus vulgaris E-value=7e-64; Carotenoid 9,10(9',10')-cleavage dioxygenase 1 OS=Arabidopsis thaliana E-value=2e-61; Carotenoid 9,10(9',10')-cleavage dioxygenase OS=Crocus sativus E-value=2e-58; Zeaxanthin 7,8(7',8')-cleavage dioxygenase, chromoplast OS=Crocus sativus E-value=1e-17; |
Length | 465 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | CTCGTTTCGGTGTTCTACCCCGCTATGCTAAGGATGAAAAACATATTAGATGGTTCGAAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825527 |
Trichome-related Gene from Literature | N/A |