| Detail of EST/Unigene BE323644 |
| Acc. | BE323644 |
| Internal Acc. | NF006E12PL1F1087 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L2, chloroplastic OS=Nicotiana tabacum E-value=3e-41; 50S ribosomal protein L2, chloroplastic OS=Solanum tuberosum E-value=3e-41; 50S ribosomal protein L2, chloroplastic OS=Solanum lycopersicum E-value=3e-41; 50S ribosomal protein L2, chloroplastic OS=Solanum bulbocastanum E-value=3e-41; 50S ribosomal protein L2, chloroplastic OS=Panax ginseng E-value=3e-41; |
| Length | 476 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF; |
| Sequence | GAATGTTGGAGTAAACCAAAAAAGTTTGGGCAGAGCCGGAGCTAAACGTTGGTTAGGTAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |