| Detail of EST/Unigene BE323729 |
| Acc. | BE323729 |
| Internal Acc. | NF007C11PL1F1082 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Photosystem II 22 kDa protein, chloroplastic OS=Spinacia oleracea E-value=2e-32; Photosystem II 22 kDa protein, chloroplastic OS=Arabidopsis thaliana E-value=2e-29; Photosystem II 22 kDa protein, chloroplastic OS=Solanum lycopersicum E-value=1e-27; Photosystem II 22 kDa protein, chloroplastic OS=Solanum sogarandinum E-value=4e-27; Photosystem II 22 kDa protein, chloroplastic OS=Nicotiana tabacum E-value=9e-27; |
| Length | 588 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF; |
| Sequence | ACCACACAACACAAACACAAGCAAGAGCTAACATAGTATAGCAATGGCGTCAAACTATGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 841033 |
| Trichome-related Gene from Literature | N/A |