Detail of EST/Unigene BE323760 |
Acc. | BE323760 |
Internal Acc. | NF008A08PL1F1053 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Malonate--CoA ligase OS=Arabidopsis thaliana E-value=1e-47; Acyl-CoA synthetase family member 3, mitochondrial OS=Mus musculus E-value=3e-19; Acyl-CoA synthetase family member 3, mitochondrial OS=Bos taurus E-value=6e-19; Acyl-CoA synthetase family member 3, mitochondrial OS=Homo sapiens E-value=3e-18; Acyl-CoA synthetase family member 3, mitochondrial OS=Xenopus laevis E-value=2e-17; |
Length | 346 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | TCTCTACGCAGGTTCCACGGTTGAGTTTTTGCCGAAGTTTAGTGTCAGTGGAATTTGGAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820862 |
Trichome-related Gene from Literature | N/A |