Detail of EST/Unigene BE323778 |
Acc. | BE323778 |
Internal Acc. | NF008D04PL1F1030 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | ATP synthase gamma chain, chloroplastic OS=Pisum sativum E-value=2e-27; ATP synthase gamma chain, chloroplastic OS=Nicotiana tabacum E-value=2e-21; ATP synthase gamma chain 1, chloroplastic OS=Arabidopsis thaliana E-value=1e-14; ATP synthase subunit gamma, chloroplastic OS=Zea mays E-value=4e-09; ATP synthase gamma chain 2, chloroplastic OS=Arabidopsis thaliana E-value=6e-09; |
Length | 266 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | CTCATCATTGCAACAATGTCTTGCTCCAATATCACCATGTTGGTCTCATCCAAACCTTCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825797 |
Trichome-related Gene from Literature | N/A |