Detail of EST/Unigene BE323848 |
Acc. | BE323848 |
Internal Acc. | NF009B05PL1F1041 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 7, chloroplastic OS=Solanum lycopersicum E-value=1e-33; Chlorophyll a-b binding protein, chloroplastic OS=Petunia hybrida E-value=1e-33; Chlorophyll a-b binding protein 6A, chloroplastic OS=Solanum lycopersicum E-value=1e-12; Chlorophyll a-b binding protein 6, chloroplastic OS=Arabidopsis thaliana E-value=4e-12; Chlorophyll a-b binding protein 1B-21, chloroplastic OS=Hordeum vulgare Ib-21 E-value=1e-11; |
Length | 320 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | TTGATCCACTTGGTTGGGGAAGTGGTTCTCCTCAGAAGCTTAAGGAGTTGAGAACAAAGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825320 |
Trichome-related Gene from Literature | N/A |