Detail of EST/Unigene BE323954 |
Acc. | BE323954 |
Internal Acc. | NF011G06PL1F1040 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Transketolase, chloroplastic OS=Zea mays E-value=1e-62; Transketolase, chloroplastic (Fragment) OS=Craterostigma plantagineum E-value=3e-62; Transketolase, chloroplastic OS=Spinacia oleracea E-value=3e-59; Transketolase, chloroplastic OS=Solanum tuberosum E-value=3e-57; Transketolase 7 OS=Craterostigma plantagineum E-value=1e-54; |
Length | 465 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | TATTGCTCTTCATAGCCCGGGATTCATTCCATACTGTGCAACTTTCTTTGTCTTCACCGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 2.2.1.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819137 |
Trichome-related Gene from Literature | N/A |