Detail of EST/Unigene BE323971 |
Acc. | BE323971 |
Internal Acc. | NF011H06PL1F1048 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Oxygen-evolving enhancer protein 1, chloroplastic OS=Pisum sativum E-value=1e-65; Oxygen-evolving enhancer protein 1, chloroplastic OS=Triticum aestivum E-value=3e-42; Oxygen-evolving enhancer protein 1-1, chloroplastic OS=Arabidopsis thaliana E-value=1e-41; Oxygen-evolving enhancer protein 1, chloroplastic OS=Fritillaria agrestis E-value=9e-38; Oxygen-evolving enhancer protein 1, chloroplastic OS=Nicotiana tabacum E-value=6e-36; |
Length | 495 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | GCAGCCTCACTCCAAGCAGCTGCTACTCTCATGCAACCAACCAAGTTACGTAGCAACAGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 836789 |
Trichome-related Gene from Literature | N/A |