Detail of EST/Unigene BE324044 |
Acc. | BE324044 |
Internal Acc. | NF012F07PL1F1059 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Dihydrodipicolinate synthase 2, chloroplastic OS=Arabidopsis thaliana E-value=3e-23; Dihydrodipicolinate synthase, chloroplastic OS=Glycine max E-value=4e-22; Dihydrodipicolinate synthase, chloroplastic OS=Nicotiana tabacum E-value=4e-21; Dihydrodipicolinate synthase 1, chloroplastic OS=Arabidopsis thaliana E-value=5e-21; Dihydrodipicolinate synthase, chloroplastic OS=Zea mays E-value=1e-17; |
Length | 419 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | CTCCGTCCGACCTCCGTATTTCTCCACAGCAGCTTGATTTCAAGTTCACTGAGGTATGGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819152 |
Trichome-related Gene from Literature | N/A |