Detail of EST/Unigene BE324231 |
Acc. | BE324231 |
Internal Acc. | NF018C08PL1F1055 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Rac-like GTP-binding protein RHO1 OS=Pisum sativum E-value=6e-21; Rac-like GTP-binding protein ARAC6 OS=Arabidopsis thaliana E-value=6e-21; Rac-like GTP-binding protein ARAC3 OS=Arabidopsis thaliana E-value=6e-21; Rac-like GTP-binding protein RAC1 OS=Lotus japonicus E-value=6e-21; Rac-like GTP-binding protein RHO1 OS=Beta vulgaris E-value=6e-21; |
Length | 276 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | TAAAATCACACTCTCATCTTCCAAATAGATGTGTGATAGTAATTGAAAGAGAAGAAGAAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829654 |
Trichome-related Gene from Literature | N/A |