Detail of EST/Unigene BE324291 |
Acc. | BE324291 |
Internal Acc. | NF020F08PL1F1064 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Peroxiredoxin Q, chloroplastic OS=Populus jackii E-value=9e-28; Peroxiredoxin Q, chloroplastic OS=Suaeda salsa E-value=3e-27; Peroxiredoxin Q, chloroplastic OS=Gentiana triflora E-value=8e-27; Peroxiredoxin Q, chloroplastic (Fragment) OS=Sedum lineare E-value=8e-27; Peroxiredoxin Q, chloroplastic OS=Triticum aestivum E-value=1e-26; |
Length | 386 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | ATCACTTTGTTCTTCCTCATCCATGGCTAAGGCTTCCCTCACTCTCCCAACCAATTCTTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.11.1.15 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |