Detail of EST/Unigene BE324354 |
Acc. | BE324354 |
Internal Acc. | NF015C04PL1F1023 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 215, chloroplastic OS=Pisum sativum E-value=6e-41; Chlorophyll a-b binding protein 4, chloroplastic OS=Solanum lycopersicum E-value=2e-37; Chlorophyll a-b binding protein, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-37; Chlorophyll a-b binding protein, chloroplastic OS=Oryza sativa subsp. indica E-value=4e-37; Chlorophyll a-b binding protein 37, chloroplastic OS=Petunia sp. E-value=5e-37; |
Length | 235 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | TAGCTTTGGCCAAAGTCGCTTCACCATGCGTCGTACTGTGAAGAGTGCTCCTGAAAGCAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 815055 |
Trichome-related Gene from Literature | N/A |