| Detail of EST/Unigene BE324439 |
| Acc. | BE324439 |
| Internal Acc. | NF018C04PL1F1023 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glyceraldehyde-3-phosphate dehydrogenase A, chloroplastic OS=Pisum sativum E-value=4e-18; Glyceraldehyde-3-phosphate dehydrogenase A, chloroplastic OS=Spinacia oleracea E-value=3e-09; Glyceraldehyde-3-phosphate dehydrogenase A, chloroplastic (Fragment) OS=Nicotiana tabacum E-value=1e-07; Glyceraldehyde-3-phosphate dehydrogenase A, chloroplastic OS=Arabidopsis thaliana E-value=7e-07; |
| Length | 168 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF; |
| Sequence | CTTGTAGGCTTAATCATGGCTTCGGCTACTTTCTCTGTAGCCAACCCAGCTCTTAAGGTA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 837848 |
| Trichome-related Gene from Literature | N/A |