| Detail of EST/Unigene BE324518 |
| Acc. | BE324518 |
| Internal Acc. | NF022D09PL1F1075 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Acylpyruvase FAHD1, mitochondrial OS=Dictyostelium discoideum E-value=1e-28; Acylpyruvase FAHD1, mitochondrial OS=Bos taurus E-value=3e-24; Uncharacterized protein ZK688.3 OS=Caenorhabditis elegans E-value=5e-23; Acylpyruvase FAHD1, mitochondrial OS=Homo sapiens E-value=6e-22; Acylpyruvase FAHD1, mitochondrial OS=Pongo abelii E-value=1e-21; |
| Length | 319 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF; |
| Sequence | AGAGTACAGAGAAATGTCGACGGCGTCTTCCTGTCAGAAACTCTTTGATTTAGGCACAAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827276 |
| Trichome-related Gene from Literature | N/A |