Detail of EST/Unigene BE324569 |
Acc. | BE324569 |
Internal Acc. | NF014D06PL1F1047 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Linoleate 13S-lipoxygenase 2-1, chloroplastic OS=Solanum tuberosum E-value=3e-58; Probable lipoxygenase 8, chloroplastic OS=Oryza sativa subsp. japonica E-value=5e-50; Lipoxygenase 2.3, chloroplastic OS=Hordeum vulgare E-value=4e-47; Lipoxygenase 7, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-45; Lipoxygenase 2, chloroplastic OS=Arabidopsis thaliana E-value=1e-44; |
Length | 566 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | TGACAACCCTGATGATAAGAGGGTTATTTTTTCCAACAAGTCATATTTACCATCTGAAAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 823650 |
Trichome-related Gene from Literature | N/A |