Detail of EST/Unigene BE324621 |
Acc. | BE324621 |
Internal Acc. | NF014G08PL1F1065 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | ATP synthase subunit c, chloroplastic OS=Ipomoea purpurea E-value=8e-19; ATP synthase subunit c, chloroplastic OS=Cicer arietinum E-value=8e-19; ATP synthase subunit c, chloroplastic OS=Pisum sativum E-value=1e-18; ATP synthase subunit c, chloroplastic OS=Pinus thunbergii E-value=2e-18; ATP synthase subunit c, chloroplastic OS=Pinus koraiensis E-value=2e-18; |
Length | 518 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | TATTGAATAACTCAAAAATGGAAATAAAGAAAAAGAAAGAACGAAGAATTAAAAGAATGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |