| Detail of EST/Unigene BE324621 |
| Acc. | BE324621 |
| Internal Acc. | NF014G08PL1F1065 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | ATP synthase subunit c, chloroplastic OS=Ipomoea purpurea E-value=8e-19; ATP synthase subunit c, chloroplastic OS=Cicer arietinum E-value=8e-19; ATP synthase subunit c, chloroplastic OS=Pisum sativum E-value=1e-18; ATP synthase subunit c, chloroplastic OS=Pinus thunbergii E-value=2e-18; ATP synthase subunit c, chloroplastic OS=Pinus koraiensis E-value=2e-18; |
| Length | 518 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF; |
| Sequence | TATTGAATAACTCAAAAATGGAAATAAAGAAAAAGAAAGAACGAAGAATTAAAAGAATGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |