Detail of EST/Unigene BE324631 |
Acc. | BE324631 |
Internal Acc. | NF024B08PL1F1062 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit XI, chloroplastic OS=Cucumis sativus E-value=5e-54; Photosystem I reaction center subunit XI, chloroplastic OS=Arabidopsis thaliana E-value=2e-52; Photosystem I reaction center subunit XI, chloroplastic OS=Spinacia oleracea E-value=3e-52; Photosystem I reaction center subunit XI, chloroplastic OS=Hordeum vulgare E-value=9e-42; Photosystem I reaction center subunit XI OS=Guillardia theta E-value=2e-23; |
Length | 530 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | AAGCCAACTCAAGTCCAGCTTCACTAGACCTTTGGTCACACCTAGAGGACTTTGTGGCTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 826892 |
Trichome-related Gene from Literature | N/A |