| Detail of EST/Unigene BE324678 |
| Acc. | BE324678 |
| Internal Acc. | NF024B05PL1F1042 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Photosystem II 10 kDa polypeptide, chloroplastic OS=Solanum tuberosum E-value=1e-45; Photosystem II 10 kDa polypeptide, chloroplastic OS=Solanum lycopersicum E-value=3e-45; Photosystem II 10 kDa polypeptide, chloroplastic OS=Nicotiana tabacum E-value=1e-44; Photosystem II 10 kDa polypeptide, chloroplastic OS=Spinacia oleracea E-value=2e-42; Photosystem II 10 kDa polypeptide, chloroplastic OS=Brassica campestris E-value=1e-40; |
| Length | 511 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF; |
| Sequence | CAAAAAAGAATTTGAAATGGCATCTTCAGTTATGGCTTCTGTGAGTTTGAAACCAACTCC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 844245 |
| Trichome-related Gene from Literature | N/A |