Detail of EST/Unigene BE324685 |
Acc. | BE324685 |
Internal Acc. | NF024D02PL1F1015 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Beta-glucosidase 11 OS=Oryza sativa subsp. japonica E-value=2e-13; Beta-glucosidase 46 OS=Arabidopsis thaliana E-value=4e-13; Beta-glucosidase 12 OS=Oryza sativa subsp. japonica E-value=4e-13; Beta-glucosidase 13 OS=Arabidopsis thaliana E-value=5e-13; Beta-glucosidase 10 OS=Oryza sativa subsp. japonica E-value=6e-13; |
Length | 339 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | TTTCATTGCTGCACATATAAACGCTACCAAATCTGCAATTGATGATGGCGTAAATGTTCG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K01229 lactase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
EC | 3.2.1.108 3.2.1.21 3.2.1.62 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842479 |
Trichome-related Gene from Literature | N/A |