Detail of EST/Unigene BE324742 |
Acc. | BE324742 |
Internal Acc. | NF017H03PL1F1029 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Oxygen-evolving enhancer protein 2, chloroplastic OS=Pisum sativum E-value=4e-73; Oxygen-evolving enhancer protein 2, chloroplastic OS=Spinacia oleracea E-value=4e-56; Oxygen-evolving enhancer protein 2, chloroplastic OS=Solanum tuberosum E-value=6e-55; Oxygen-evolving enhancer protein 2, chloroplastic OS=Solanum lycopersicum E-value=4e-54; Oxygen-evolving enhancer protein 2-1, chloroplastic OS=Nicotiana tabacum E-value=2e-52; |
Length | 591 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | AAAATAAACTATACTAGACTCTAGCAAAATGGCCTCTACACAATGCTTCTTGCACCCCCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 837178 |
Trichome-related Gene from Literature | N/A |