Detail of EST/Unigene BE324774 |
Acc. | BE324774 |
Internal Acc. | NF017E02PL1F1008 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Transketolase, chloroplastic OS=Solanum tuberosum E-value=9e-94; Transketolase, chloroplastic OS=Spinacia oleracea E-value=3e-93; Transketolase, chloroplastic (Fragment) OS=Craterostigma plantagineum E-value=5e-92; Transketolase, chloroplastic OS=Zea mays E-value=1e-88; Transketolase 10 OS=Craterostigma plantagineum E-value=1e-79; |
Length | 627 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | GGAAAGCTAATTGCATTTTATGATGATAACCACATTTCTATTGATGGTGACACTGAAATT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 2.2.1.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825246 |
Trichome-related Gene from Literature | N/A |