| Detail of EST/Unigene BE324774 |
| Acc. | BE324774 |
| Internal Acc. | NF017E02PL1F1008 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Transketolase, chloroplastic OS=Solanum tuberosum E-value=9e-94; Transketolase, chloroplastic OS=Spinacia oleracea E-value=3e-93; Transketolase, chloroplastic (Fragment) OS=Craterostigma plantagineum E-value=5e-92; Transketolase, chloroplastic OS=Zea mays E-value=1e-88; Transketolase 10 OS=Craterostigma plantagineum E-value=1e-79; |
| Length | 627 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF; |
| Sequence | GGAAAGCTAATTGCATTTTATGATGATAACCACATTTCTATTGATGGTGACACTGAAATT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 2.2.1.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 825246 |
| Trichome-related Gene from Literature | N/A |