Detail of EST/Unigene BE324778 |
Acc. | BE324778 |
Internal Acc. | NF017G03PL1F1021 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ferredoxin-1, chloroplastic OS=Pisum sativum E-value=3e-56; Ferredoxin-1, chloroplastic OS=Mesembryanthemum crystallinum E-value=3e-39; Ferredoxin-1, chloroplastic OS=Arabidopsis thaliana E-value=4e-39; Ferredoxin-2, chloroplastic OS=Arabidopsis thaliana E-value=1e-38; Ferredoxin, chloroplastic OS=Capsicum annuum E-value=3e-38; |
Length | 505 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | AGTAATGGCAACCACACCTGCTTTGTATGGAACTGCAGTGAGCACCTCCTTCCTTAGGAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 837639 |
Trichome-related Gene from Literature | N/A |