Detail of EST/Unigene BE324849 |
Acc. | BE324849 |
Internal Acc. | NF021D12PL1F1095 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | ATP synthase subunit a, chloroplastic OS=Pisum sativum E-value=1e-85; ATP synthase subunit a, chloroplastic OS=Cicer arietinum E-value=2e-84; ATP synthase subunit a, chloroplastic OS=Lotus japonicus E-value=2e-81; ATP synthase subunit a, chloroplastic OS=Glycine max E-value=4e-79; ATP synthase subunit a, chloroplastic OS=Lactuca sativa E-value=2e-78; |
Length | 671 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | ATGGAATCGGTTATTATAGCATTACAAAATTGTGCAAAAATAAATATTTTGTGATTAGTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |