Detail of EST/Unigene BE324890 |
Acc. | BE324890 |
Internal Acc. | NF023C11PL1F1083 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Pyruvate dehydrogenase E1 component subunit alpha, mitochondrial OS=Pisum sativum E-value=3e-22; Pyruvate dehydrogenase E1 component subunit alpha-1, mitochondrial OS=Arabidopsis thaliana E-value=2e-16; Pyruvate dehydrogenase E1 component subunit alpha, mitochondrial OS=Solanum tuberosum E-value=3e-15; Pyruvate dehydrogenase E1 component subunit alpha-2, mitochondrial OS=Arabidopsis thaliana E-value=2e-12; |
Length | 601 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | CTTTTTCTCCCTCAATTTTCGAATCAACCAATACAAAATTCCCCACTCACACACACATCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.2.4.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |