| Detail of EST/Unigene BE324912 |
| Acc. | BE324912 |
| Internal Acc. | NF023D11PL1F1091 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 6, chloroplastic OS=Arabidopsis thaliana E-value=3e-31; Chlorophyll a-b binding protein 1B-21, chloroplastic OS=Hordeum vulgare Ib-21 E-value=2e-30; Chlorophyll a-b binding protein 6A, chloroplastic OS=Solanum lycopersicum E-value=1e-29; Chlorophyll a-b binding protein, chloroplastic OS=Spinacia oleracea E-value=7e-15; Chlorophyll a-b binding protein 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=7e-15; |
| Length | 389 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF; |
| Sequence | CCTTGCGGTGCTTTTGATCCTTTGGGATACTCTAAAGACCCTAAAAAGTTCCATGAATAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 824654 |
| Trichome-related Gene from Literature | N/A |