Detail of EST/Unigene BE324952 |
Acc. | BE324952 |
Internal Acc. | NF019A12PL1F1086 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase DHAR3, chloroplastic OS=Arabidopsis thaliana E-value=1e-51; Glutathione S-transferase DHAR2 OS=Arabidopsis thaliana E-value=5e-41; Glutathione S-transferase DHAR1, mitochondrial OS=Arabidopsis thaliana E-value=6e-38; Putative glutathione S-transferase DHAR4 OS=Arabidopsis thaliana E-value=5e-33; Glutathione S-transferase omega-1 OS=Rattus norvegicus E-value=2e-10; |
Length | 678 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | AACACAACCACATCACCTTCATCTCTTACCCCTACAAACAAACGCACACAAACGTTACCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
EC | 2.5.1.18 |
Transcription Factor Family | |
Transporter Classification Family | 1.A.1 Voltage-gated ion channel superfamily VIC; 1.A.12 Organellar chloride channel O-ClC |
Probeset |
|
Corresponding NCBI Gene | 831532 |
Trichome-related Gene from Literature | N/A |